Page 77 - Genetics_From_Genes_to_Genomes_6th_FULL_Part3

11.2 Genotyping a Known Disease-Causing Mutation 371

11.2 Genotyping a Known Figure 11.9 Overview of the polymerase chain reaction
(PCR). The reaction amplifies a target region of genomic DNA
Disease‑Causing Mutation defined by the 5′ ends of the two primers, making a PCR product.
To help you understand the basis of PCR, the Watson and Crick
strands of the same region of DNA are shown in different colors.
learning objectives Target Region
1. Outline the steps by which the polymerase chain 5' ... CCT CCCACAGCTCCTGGGCAACGTGCCTGGCCCCATCACTTTGGCAA AGAATTC...3'
reaction (PCR) amplifies a specific region of a genome. 3' ... GGT GGGTGTCGAGGACCCGTTGCACGGACCGGGGTAGTGAAACCGTT TCTTAAG...5'
2. Describe how the sequencing or sizing of PCR products Genomic
can elucidate genotypes. DNA
3. Explain how PCR can be used to genotype fetuses in Denature genomic DNA;
utero or embryos prior to implantation. hybridize to primers

The ability to genotype individuals for genetic diseases 5' ... CCT CCCACAGCTCCTGGGCAACGTGCCTGGCCCCATCACTTTGGCAA AGAATTC...3'
provides information that can impact lives profoundly. If a 3' GGGTAGTGAAACCGTT 5'
person is diagnosed as having a genetic disease for which Primer 1
treatments are available, knowledge of the DNA genotype 5' CCCACAGCTCCTGGGC 3' Primer 2
could save his or her life. Even if the condition cannot be
treated, the genotyping of prospective parents, a fetus car- 3' ... GGT GGGTGTCGAGGACCCGTTGCACGGACCGGGGTAGTGAAACCGTT TCTTAAG...5'
ried by a mother, or embryos created by in vitro fertiliza-
tion allows families to make informed reproductive
decisions. ~30 rounds of PCR
amplification
The ability to determine whether a person is homozy-
gous or heterozygous for a disease-causing allele of course
presumes that scientists already know the precise change of 5' CCCACAGCTCCTGGGCAACGTGCTGGCCCCATCACTTTGGCAA 3'
nucleotides responsible for the disease. For certain diseases 3' GGGTGTCGAGGACCCGTTGCACGACCGGGGTAGTGAAACCGTT 5'
such as sickle-cell anemia, the identity of the disease-
PCR Product
causing mutation is clear because we know how a particu- (billions of copies)
lar protein (such as hemoglobin) is altered in the disease.
But in most cases, the phenotype of the disease does not
provide clear information about the disease gene. Later
sections of this chapter will describe more general strate- with minute amounts of DNA, such as that found in a sin-
gies to find mutations associated with various diseases. gle sperm or hair follicle, researchers can make a billion or
Once the mutation is identified, individuals can be geno- more copies of a short, defined portion of that genome in
typed by the methods we now discuss. just a few hours.
As shown in Fig. 11.9, PCR amplifies a target region
of DNA. Two 16- to 30-base-long oligonucleotides, the
The Polymerase Chain Reaction (PCR) PCR primers, define the ends of the target region. The in-
Amplifies Defined Regions of a Genome vestigator synthesizes these primers based on prior knowl-
edge of the genome. One oligonucleotide is complementary
Determining whether a person is homozygous or heterozy- to one strand of DNA at one end of the region; the other
gous for a disease-causing allele, or homozygous for a oligonucleotide is complementary to the other strand at the
normal allele of the same gene, implies that you can iso- other end of the region. If these primers are drawn as 5′→3′
late that gene from the person’s genome and analyze the arrows to indicate their polarity, the arrows will point
alleles by looking at the purified DNA. But genes are rare toward each other through the target region (Fig. 11.9). For
targets in complex genomes: The gene for the β chain of DNA genotyping, the object of the PCR is to amplify
hemoglobin, for example, spans only about 1400 of the sequences within the target region that may have different
3,000,000,000 nucleotide pairs in the haploid human allelic forms.
genome. In 1985, Kary Mullis invented one of the most The process of amplification is initiated by the hybrid-
powerful techniques in molecular biology, called the poly- ization of these synthetic oligonucleotides to one or more
merase chain reaction (PCR), to deal with this problem denatured template DNA molecules (melted into single
of looking for the needle of a gene in the haystack of the strands) within the sample of genomic DNA to be analyzed
genome. PCR is remarkably fast and efficient. Starting (Fig. 11.10). The oligonucleotides act as primers that allow