Page 57 - Genetics_From_Genes_to_Genomes_6th_FULL_Part2

216 Chapter 6 DNA Structure, Replication, and Recombination

Remember that these fragments are connected only of DNA of any given sequence. You have used the
after the RNA primers at their ends have been re- machine to synthesize the following three DNA
moved. Given this information, infer the type of molecules:
chemical bond whose formation is catalyzed by (DNA 1)
DNA ligase and whether or not a source of energy 5′ CTACTACGGATCGGG 3′
will be required to promote this reaction. Explain (DNA 2) 5′ CCAGTCCCGATCCGT 3′
why DNA ligase and not DNA polymerase is (DNA 3) 5′ AGTAGCCAGTGGGGAAAAACCCCACTGG 3′
required to join Okazaki fragments. Now you add the DNA molecules either singly or
22. The bases of one of the strands of DNA in a region in combination to reaction tubes containing DNA
where DNA replication begins are shown at the end polymerase, dATP, dCTP, dGTP, and dTTP in a
of this problem. What is the sequence of the primer buffered solution that allows DNA polymerase to
that is synthesized complementary to the bases in function. For each of the reaction tubes, indicate
bold? (Indicate the 5′ and 3′ ends of the sequence.) whether DNA polymerase will synthesize any new
DNA molecules, and if so, write the sequence(s) of
5′ AGGCCTCGAATTCGTATAGCTTTCAGAAA 3′
any such DNAs.
23. Replicating structures in DNA can be observed in the a. DNA 1 plus DNA 3
electron microscope. Regions being replicated appear
as bubbles. b. DNA 2 plus DNA 3
a. Assuming bidirectional replication, how many c. DNA 1 plus DNA 2
origins of replication are active in this DNA d. DNA 3 only
molecule?
b. How many replication forks are present?
c. Assuming that all replication forks move at the Section 6.5
same speed, which origin of replication was acti- 29. Bacterial cells were coinfected with two types of bac-
vated last? teriophage lambda: One carried the c allele and the
+
other the c allele. After the cells lysed, progeny bac-
teriophage were collected. When a single such prog-
eny bacteriophage was used to infect a new bacterial
cell, it was observed in rare cases that some of the
resulting phage progeny were c and others were c.
+
Explain this result.
24. Indicate the role of each of the following in DNA rep-
−
lication: (a) topoisomerase, (b) helicase, (c) primase, 30. A yeast strain with a mutant spo11 allele has been
and (d) ligase. isolated. The mutant allele is nonfunctional; it makes
25. Draw a diagram of replication that is occurring at the no Spo11 protein. What do you suppose is the pheno-
type of this mutant strain?
end of a double-stranded linear chromosome. Show
the leading and lagging strands with their primers. 31. Imagine that you have done a cross between two
(Indicate the 5′ and 3′ ends of the strands.) What dif- strains of yeast, one of which has the genotype A B C
ficulty is encountered in producing copies of both and the other a b c, where the letters refer to three
DNA strands at the end of a chromosome? rather closely linked genes in the order given. You
26. Figure 6.18 depicts Watson and Crick’s initial proposal examine many tetrads resulting from this cross, and
you find two that do not contain the expected two B
for how the double-helical structure of DNA accounts
for DNA replication. Based on our current knowledge, and two b spores. In tetrad I, the spores are A B C, A
this figure contains a serious error due to oversimplifi- B C, a B c, and a b c. In tetrad II, the spores are A B
C, A b c, a b C, and a b c. How have these unusual
cation. Identify the problem with this figure. tetrads arisen?
27. Researchers have discovered that during replication of 32. The Neurospora octad shown came from a cross be-
the circular DNA chromosome of the animal virus tween a and a strains.
−
+
SV40, the two newly completed daughter double he-
lixes are intertwined. What would have to happen for a. Is this an MI or an MII octad or neither? Explain.
the circles to come apart? b. Diagram the production of this octad.
28. A DNA synthesizer is a machine that uses automated c. Is it possible to observe evidence of heteroduplex
chemical synthesis to generate short, single strands formation in a Neurospora ascus even if gene