Page 53 - Genetics_From_Genes_to_Genomes_6th_FULL_Part2

212 Chapter 6 DNA Structure, Replication, and Recombination

Because CRISPR/Cas9 causes double- strand breaks at a
specific genomic location determined by the sequence of the essential concepts
CRISPR RNA, researchers can now induce recombination • Site-specific recombination is crossing-over between two
to occur at high frequency at any specific location of the short DNA target sites catalyzed by a recombinase enzyme.
genome. As will be seen in Chapter 18, this recombination • Researchers can import target sites and the
allows scientists to alter the sequence of DNA near the corresponding recombinase gene into an organism’s
breakpoint in any desired way. The potential significance genome to promote site-specific recombination at a
of this newfound ability to alter genomes is staggering. Just particular genomic location, at a particular time, and in a
to cite one example, such pinpoint genome editing may al- particular tissue.
low for gene therapy in which mutant alleles in the ge- • The CRISPR/Cas9 system can induce double-strand
nomes of the somatic cells of a person suffering from a breaks at almost any position in the genome. The fact that
genetic disease such as cystic fibrosis could be changed to these double-strand breaks are recombinogenic allows
wild-type alleles. scientists to edit genomes in the vicinity of the breakage.

WHAT’S NEXT

The Watson-Crick model for the structure of DNA, the different proteins, replication and recombination both oc-
single most important biological discovery of the twentieth cur with extremely high fidelity—normally not a single
century, clarified how the genetic material fulfills its pri- base pair is gained or lost. Occasionally, however, errors do
mary functions of carrying and accurately reproducing in- occur, providing the genetic basis of evolution.
formation: Each DNA molecule carries one of a vast DNA copying or recombination errors that occur
number of potential arrangements of the four nucleotide within genes sometimes produce dramatic changes in
building blocks (A, T, G, and C). The model also suggested phenotype. How do mutations in genes arise? And how
how base complementarity could provide a mechanism for did we come to understand that different alleles of genes
faithful DNA replication. We have further seen how the produce their phenotypic effects through the proteins that
structure of DNA enables the recombining of genetic infor- they specify?
mation from maternal and paternal chromosomes. We begin to answer these questions in Chapter 7. We
Unlike its ability to carry information, DNA’s capaci- first describe the molecular processes that lead to mutation.
ties for replication and recombination are not solely prop- Next, you will see that scientists used mutations to deter-
erties of the DNA molecule itself. Rather they depend on mine what a gene actually is—a linear sequence of base
the cell’s complex enzymatic machinery. But even though pairs in DNA, and what a gene does—it encodes the infor-
they rely on the complicated orchestration of many mation for producing a protein.

SOLVED PROBLEMS

5′ TAAGCGTAACCCGCTAA CGTATGCGAAC GGGTCCTATTAACGTGCGTACAC 3′
3′ ATTCGCATTGGGCGATT GCATACGCTTG CCCAGGATAATTGCACGCATGTG 5′

I. Imagine that the double-stranded DNA molecule Answer
shown was broken at the sites indicated by spaces in To answer this question, you need to keep in mind the po-
the sequence, and that before the breaks were re- larity of the DNA strands involved.
paired, the 11 base pair DNA fragment between the The top strand has the polarity left to right of 5′ to 3′.
breaks was reversed (inverted). What would be the The reversed region must be rejoined with the same polarity.
base sequence of the repaired molecule? Explain your Label the polarity of the strands within the inverting region.
reasoning. To have a 5′-to-3′ polarity maintained on the top strand, the
DNA: © Design Pics/Bilderbuch RF