Page 55 - Genetics_From_Genes_to_Genomes_6th_FULL_Part2
P. 55
214 Chapter 6 DNA Structure, Replication, and Recombination
Section 6.1 Write the sequence of the corresponding region of the
2. Griffith, in his 1928 experiments, demonstrated that other DNA strand of this gene, noting the polarity.
bacterial strains could be genetically transformed. The What do the dots before and after the given sequence
evidence that DNA was the transforming principle represent?
responsible for this phenomenon came later. What 10. When a double-stranded DNA molecule is exposed to
was the key experiment that Avery, MacCleod, and high temperature, the two strands separate, and the
McCarty performed to prove that DNA was responsible molecule loses its helical form. We say the DNA has
for the genetic change from rough cells into smooth been denatured. (Denaturation also occurs when
cells? DNA is exposed to acid or alkaline solutions.)
3. During bacterial transformation, DNA that enters a a. Regions of the DNA that contain many A–T base
cell is not an intact chromosome; instead it consists of pairs are the first to become denatured as the tem-
randomly generated fragments of chromosomal DNA. perature of a DNA solution is raised. Thinking
In a transformation where the donor DNA was from a about the chemical structure of the DNA mole-
+
+
+
bacterial strain that was a b c and the recipient was cule, why do you think the A–T-rich regions
+
a b c, 55% of the cells that became a were also trans- denature first?
+
+
+
formed to c . But only 2% of the a cells were b . Is b. If the temperature is lowered, the original DNA
gene b or c closer to gene a? strands can reanneal, or renature. In addition to the
4. Nitrogen and carbon are more abundant in proteins full double-stranded molecules, some molecules of
than sulfur. Why did Hershey and Chase use radioac- the type shown here are seen when the molecules
tive sulfur instead of nitrogen and carbon to label the are examined under the electron microscope. How
protein portion of their bacteriophages in their experi- can you explain these structures?
ments to determine whether parental protein or paren-
tal DNA is necessary for progeny phage production?
Section 6.2
5. If 30% of the bases in human DNA are A, (a) what 11. A particular virus with DNA as its genetic material
percentage are C? (b) What percentage are T? has the following proportions of nucleotides: 20% A,
(c) What percentage are G? 35% T, 25% G, and 20% C. How can you explain this
6. Which of the following statements are true about double- result?
stranded DNA?
a. A + C = T + G
b. A + G = C + T Section 6.3
c. A + T = G + C 12. The underlying structure of DNA is very simple, con-
d. A/G = C/T sisting of only four possible building blocks.
e. A/G = T/C a. How is it possible for DNA to carry complex
genetic information if its structure is so simple?
f. (C + A) / (G + T) = 1 b. What are these building blocks? Can each block be
7. Imagine you have three test tubes containing identical subdivided into smaller units, and if so, what are
solutions of purified, double-stranded human DNA. they? What kinds of chemical bonds link the build-
You expose the DNA in tube 1 to an agent that breaks ing blocks?
the sugar-phosphate (phosphodiester) bonds. You c. How does the underlying structure of RNA differ
expose the DNA in tube 2 to an agent that breaks the from that of DNA?
bonds that attach the bases to the sugars. You expose
the DNA in tube 3 to an agent that breaks the hydro- 13. An RNA virus that infects plant cells is copied into a
gen bonds. After treatment, how would the structures DNA molecule after it enters the plant cell. What
of the molecules in the three tubes differ? would be the sequence of bases in the first strand of
8. What information about the structure of DNA was DNA made complementary to the section of viral
RNA shown here?
obtained from X-ray crystallographic data?
9. A portion of one DNA strand of the human gene 5′ CCCUUGGAACUACAAAGCCGAGAUUAA 3′
responsible for cystic fibrosis is 14. Bacterial transformation and bacteriophage labeling
5′.....ATAGCAGAGCACCATTCTG.....3′ experiments proved that DNA was the hereditary