Page 54 - Genetics_From_Genes_to_Genomes_6th_FULL_Part2

Problems 213

fragment that is reversed must also be flipped over, so the (You might also consider using radioactively labeled
strand that was formerly on the bottom is now on top. ribose or deoxyribose to differentiate between an RNA-
and DNA-containing virus. Technically this does not work
5′ 3′
TAAGCGTAACCCGCTAAGTTCGCATACGGGGTCCTATTAACGTGCGTACAC as well because the radioactive sugars are processed by
ATTCGCATTGGGCGATTCAAGCGTATGCCCCAGGATAATTGCACGCATGTG cells before they become incorporated into nucleic acid,
3′ 5′ thereby obscuring the results.)
II. A new virus has recently been discovered that infects III. If you expose a culture of human cells (for example,
3
human lymphocytes. The virus can be grown in the HeLa cells) to H-thymidine during S phase, how
laboratory using cultured lymphocytes as host cells. would the radioactivity be distributed over a pair of
Design an experiment using a radioactive label that homologous chromosomes at metaphase? Would the
would tell you if the virus contains DNA or RNA. radioactivity be in (a) one chromatid of one homolog,
(b) both chromatids of one homolog, (c) one chroma-
Answer tid each of both homologs, (d) both chromatids of
Use your knowledge of the differences between DNA and both homologs, or (e) some other pattern? Choose the
correct answer and explain your reasoning.
RNA to answer this question. RNA contains uracil instead of
the thymine found in DNA. You could set up one culture in
which you add radioactive uracil to the medium and a sec- Answer
ond one in which you add radioactive thymine to the culture. This problem requires application of your knowledge of the
After the viruses have infected cells and produced more new molecular structure and replication of DNA and how it re-
viruses, collect the newly synthesized virus. Determine lates to chromatids and homologs. DNA replication occurs
3
which culture produced radioactive viruses. If the virus con- during S phase, so the H-thymidine would be incorporated
tains RNA, the collected virus grown in medium containing into the new DNA strands. A chromatid is a replicated
radioactive uracil will be radioactive, but the virus grown in DNA molecule, and each new DNA molecule contains one
radioactive thymine will not be radioactive. If the virus con- new strand of DNA (semiconservative replication). The ra-
tains DNA, the collected virus from the culture containing dioactivity would be in both chromatids of both homologs
radioactive thymine will be radioactive, but the virus from (answer d).
the radioactive uracil culture will not.

PROBLEMS

Vocabulary h. Okazaki 8. two nitrogenous bases that
fragments can pair via hydrogen bonds
1. For each of the terms in the left column, choose the
best matching phrase in the right column. i. purine 9. catalyzes site-specific
recombination
a. transformation 1. the strand that is synthesized
discontinuously during replication j. topoisomerases 10. a nitrogenous base containing
a single ring
b. bacteriophage 2. the sugar within the nucleotide
subunits of DNA k. semiconservative 11. a short sequence of bases
replication where unwinding of the double
c. pyrimidine 3. a nitrogenous base containing a helix for replication begins
double ring
l. lagging strand 12. a virus that infects bacteria
d. deoxyribose 4. noncovalent bonds that hold the
two strands of the double helix m. telomeres 13. short DNA fragments formed
together by discontinuous replication of
one of the strands
e. hydrogen bonds 5. Meselson and Stahl experiment
n. recombinase 14. enzymes involved in controlling
f. complementary bases 6. Griffith experiment DNA supercoiling
g. origin 7. structures at ends of eukaryotic
chromosomes