Page 101 - Genetics_From_Genes_to_Genomes_6th_FULL_Part3

Problems 395

a. Draw a cladogram similar to that in Fig. 11.6b to Section 11.2
show the evolutionary relationships among these 10. Using PCR, you want to amplify an approximately 1 kb
three species. exon of the human autosomal gene encoding the
b. The data reveal six polymorphisms among these enzyme phenylalanine hydroxylase from the genomic
eight genomes, at positions 2 (A or G), 3 (A or T), DNA of a patient suffering from the autosomal reces-
4 (G or T), 7 (C or T), 8 (C or T), and 9 (G or T). sive condition phenylketonuria (PKU).
On your cladogram, indicate approximately when a. Why might you wish to perform this PCR amplifi-
the mutations that produced each of these poly- cation in the first place, given that the sequence of
morphisms occurred. For each allele, state whether the human genome has already been determined?
it is ancestral, derived, or that you can’t tell.
c. Infer the sequences in (i) the last common ancestor b. Calculate the number of template molecules that
are present if you set up a PCR reaction using
of humans and chimpanzees, and (ii) the last com- 1 nanogram (1 × 10 grams) of chromosomal
−9
mon ancestor of all three species. Use a question DNA from blood cells as the template. Assume that
mark (?) to represent any uncertainty. each haploid genome contains only a single gene
for phenylalanine hydroxylase and that the molecu-
Genome
(haploid) Gorilla Chimpanzee Human lar weight of a base pair is 660 grams per mole. The
9
haploid human genome contains 3 × 10 base pairs.
1 CATGTCCTGA CGAGTCCTGA CAAGTCCTGA
2 CATGTCCTTA CAAGTCCTGA CAATTCCTGA c. Calculate the number of PCR product molecules
3 CAAGTCCCGA CAATTCTTGA you will obtain if you perform 25 PCR cycles and
the yield from each cycle is exactly twice that of
9. In 2015, an international team of scientists assembled the previous cycle. What would be the mass of
the complete genome sequences of two different these PCR products taken together?
woolly mammoths. Both specimens were discovered 11. Which of the following set(s) of primers a–d could
buried in the permafrost of Siberia, the coldest inhab- you use to amplify the following target DNA se-
ited place on earth. Through radiocarbon dating, it quence, which is part of the last protein-coding exon
was determined that one of the mammoths, found on of the CFTR gene?
Wrangel Island off the Siberian coast, died about
4000 years ago; the other mammoth, found in the 5′ GGCTAAGATCTGAATTTTCCGAG ... TTGGGCAATAATGTAGCGCCTT 3′
town of Oimyakon, died about 45,000 years ago. 3′ CCGATTCTAGACTTAAAAGGCTC ... AACCCGTTATTACATCGCGGAA 5′
Analysis revealed that the genome sequences of a. 5′ GGAAAATTCAGATCTTAG 3′;
these two animals differed significantly in the distri- 5′ TGGGCAATAATGTAGCGC 3′
bution of base pairs at which they are either homozy- b. 5′ GCTAAGATCTGAATTTTC 3′;
gous or heterozygous. The Wrangel Island woolly 3′ ACCCGTTATTACATCGCG 5′
mammoth had an extreme excess of runs of homozy- c. 3′ GATTCTAGACTTAAAGGC 5′;
gosity (ROHs), regions in which the animal was ho- 3′ ACCCGTTATTACATCGCG 5′
mozygous for all of the base pairs. About 23.4% of
the Wrangel Island animal’s genome was composed of d. 5′ GCTAAGATCTGAATTTTC 3′;
ROHs that were greater than 500 kb in length; some 5′ TGGGCAATAATGTAGCGC 3′
of these ROHs were in excess of 5 Mb long. In con- 12. The previous problem raises several interesting ques-
trast, only 0.83% of the Oimyakon animal’s genome tions about the design of PCR primers.
consisted of ROHs longer than 500 kb. a. How can you be sure that the two 18-nucleotide-long
a. Explain how polymorphisms are detected when se- primers you chose as your answer to Problem 11 will
quencing a genome. How would researchers know, amplify only an exon of the CFTR gene, but no other
for any particular base pair, whether a genome is region, from a sample of human genomic DNA?
homozygous or heterozygous? b. Primers used in PCR are generally at least 16 nu-
b. What does the extreme excess of ROHs in the cleotides long. Why do you think the lower limit
Wrangel Island mammoth genome suggest about would be approximately 16?
that animal’s parents? c. Suppose one of the primers in your answer to
c. The Wrangel Island woolly mammoth is thought to Problem 11 had a mismatch with a single base in
have belonged to the last population on earth be- the genomic DNA of a particular individual.
fore the species went extinct about 4000 years ago. Would you be more likely to obtain a PCR product
The answer to part (b) suggests one possible reason from this genomic DNA if the mismatch was at the
for the woolly mammoth’s extinction. Explain. 5′ end or at the 3′ end of the primer? Why?