Page 105 - Genetics_From_Genes_to_Genomes_6th_FULL_Part3

Problems 399

that you can use to find the critical bands, using the c. Why is no hybridization seen at 80°C?
edge of a piece of paper as a guide. d. Why do you see strong hybridization of all ge-
a. Sperm are haploid, but the semen sample shows nomic DNA probes to both ASOs at 40°C?
two different-sized PCR products for certain loci. e. What are the genotypes of the seven embryos?
How is this possible? Which of these embryos would you choose to im-
b. Is any locus on the X chromosome? If so, identify it. plant into the mother’s uterus to avoid the possibil-
c. Is any locus on the Y chromosome? If so, which ity that the child would have sickle-cell anemia?
one? 23. A partial sequence of the wild-type Hbβ allele is
A
d. Explain why these results demonstrate that none of shown here (the top strand is the RNA-like coding
the four individuals is the rapist. What pattern strand, and the location of the disease-causing muta-
would you expect by analyzing mouth swab DNA tion is underlined):
from the rapist?
5′ ATGGTGCACCTGACTCCTGAGGAGAAGTCGCCG 3′
e. Do these results nonetheless provide any informa- 3′ TACCACGTGGACTGAGGACTCCTCTTCAGCGGC 5′
tion that could help catch the rapist? If so, be as S
specific as possible. and the sickle-cell allele HBβ sequence is:
f. The two orange bands amplified by PCR from the 5′ ATGGTGCACCTGACTCCTGTGGAGAAGTCGCCG 3′
semen are 200 and 212 bp long. How many tan- 3′ TACCACGTGGACTGAGGACACCTCTTCAGCGGC 5′
dem repeats of the SSR repeat unit are found in
the two alleles of this locus in the rapist’s genomic Design two 21-nucleotide-long ASOs that could be
DNA? (Assume that the PCR products are the attached to a silicon chip for the microarray analysis
shortest possible and that the repeat unit for this performed in Problem 22. Two possibilities exist for
locus is TCCG.) each ASO; you only need to show one possibility for
each.
22. Microarrays were used to determine the genotypes
of seven embryos (made by in vitro fertilization) 24. a. In Fig. 11.17b, PCR is performed to amplify ge-
with regard to sickle-cell anemia. Each pair of nomic DNA for genotyping on microarrays. This
squares in the accompanying figure represents two PCR reaction requires only a single primer, but
ASOs, one specific for the Hbβ allele (A) and the normally, PCR requires two primers. Why does
A
other for the HBβ allele (T), attached to a chip of only a single primer suffice in this case?
S
silicon and hybridized with fluorescently labeled b. Again in Fig. 11.17b, genomic DNA was cut with
PCR product from a single cell from one of the a restriction enzyme before its PCR amplification.
embryos. The hybridizations were performed at What kind of restriction enzyme would be most ef-
three different temperatures (80°C, 60°C, and fective for this purpose: Would it create sticky ends
40°C) as shown. or blunt ends? Would it recognize a site made of
4 bp, 6 bp, or 8 bp?
25. The following figure shows a partial microarray
analysis for members of a nuclear family. The eight
SNP loci examined are evenly spaced at about 10 Mb
intervals on chromosome 4, and they are shown on
the microarray in their actual order on this chromo-
some. For the time being, focus your attention only
on the two parents and ignore whether they are af-
fected or unaffected.
a. Write out the complete genotype for all the DNA
markers in both parents.
b. The microarray data indicate that one SNP locus
has three alleles in this family. Which one?
a. Why do you think the PCR step is needed for this c. How would you know that these loci are in fact on
microarray analysis? chromosome 4 and are about 10 Mb apart?
b. Make a sketch of the location in genomic DNA of d. About what percentage of the total length of chro-
the PCR primers relative to the sickle-cell muta- mosome 4 is present in the region between DNA
tion. Indicate the 5′-to-3′ polarities of all DNA markers 1 and 8? (Chromosome 4 is 191 Mb long;
molecules involved. it is the fourth largest in the human genome.)