Page 110 - Genetics_From_Genes_to_Genomes_6th_FULL_Part3
P. 110

404    Chapter 11    Analyzing Genomic Variation


                  d. At an eighth locus, 1500 reads of a single type of   Individual 1:
                    sequence were found. Provide a possible explana-   5′ CAACGCTTAGGATGTGCGGAGCCT 3′
                    tion for this result, being as specific as possible.  and
                                                                       5′ CAACGCTTAGGATGTGCGGAGACT 3′
                  Locus        Sequences          Number of reads
                                                                       Individual 2:
                    1    α:  TCTTTGGTAAACGCAAG        1000
                                                                       5′ CAACGCTTAGGATGTGAGGAGCCT 3′
                    2   α:  GTACCGGAGGCAGCCTC          500
                        β:  GTACCGGCGGCAGCCTC          500
                                                                       Individual 3:
                    3   α:  AGCCATTGCGGATCCGA          950
                        β:  AGCTATTGCGGATCCGA           50             5′ CAACGCTTAGGATGTGCGGAGCCT 3′
                    4   α:  GGGGCCTTATGATAAGG           50             and
                    5   α:  CAGTTCCTGGAGTTGTA          550             5′ CAACGCTTAGGATGGCGGAGCCT 3′
                        β:  CAGTTCATGGAGTTGTA          450
                    6   α:  GCAGCCCGTGCTGTTAA          500             Individual 4:
                        β:  GCAGCCCGTGCTGTCAA          450             5′ CAACGCTTAGGATGTGCGGAGCCT 3′
                    7   α:  CACTCAGTCCTACGGAC          500             and
                        β:  CACTCGGTCCTACGGAC          450             5′ CAACGCTTAGGATGTGTGGAGCCT 3′
                        γ:  CACTCAGTCCTAAGGAC           50
                                                                       a.  The first exon of the RefSeq copy of this gene in-
                                                                         cludes the start codon. Write as much of the amino
                41.  Table 11.2 and Fig. 11.27 together portray the search   acid sequence of the encoded protein as possible,
                  for the mutation causing Nic Volker’s severe inflam-   indicating the N-to-C polarity.
                  matory bowel disease. Neither of Nic’s parents had
                  the condition, so geneticists narrowed their investiga-  b. Are any of these individuals homozygotes? If so,
                  tion by focusing on rare variants that showed a reces-  which person and what allele?
                  sive pattern and those on the X chromosome.          c.  Is the inheritance of Brugada syndrome among
                  a.  For candidate variants on an autosome, would the   these individuals dominant or recessive?
                    researchers have looked only for variants for which   d. Is Brugada syndrome associated with allelic het-
                    Nic is homozygous? Explain.                          erogeneity?
                  b. Apart from the recessive and X-linked hypotheses,   e.  Are any of these individuals compound heterozy-
                    do any other possible explanations exist for Nic’s   gotes?
                    condition?                                         f.  Do the data show any evidence for locus heteroge-
                  c.  The causative mutation was pinpointed by analyz-   neity?
                    ing only Nic’s exome, because at the time of these   g. Which person has normal heart function?
                    investigations, whole-genome or whole-exome se-    h. For each variant from the RefSeq, describe:
                    quencing was too expensive to perform on his         (i) what the mutation does to the coding sequence;
                    parents. How could you determine inexpensively       and (ii) whether the variation is a loss-of-function
                    whether or not this mutation occurred de novo in     allele, a gain-of-function allele, or a wild-type
                    the germ line of one of his parents (that is, during   allele.
                    the formation of the particular egg or sperm that
                    produced Nic)? Your answer should not involve      i.  For each variant, indicate which of the following
                    whole-genome or whole-exome sequencing.              terms apply: null, hypomorphic, hypermorphic,
              42.  The human RefSeq of the entire first exon of a gene   nonsense, frameshift, missense, silent, SNP, DIP,
                                                                         SSR, anonymous.
                  involved in Brugada syndrome (a cardiac disorder
                  characterized by an abnormal electrocardiogram and   j.  Is the function of this gene haploinsufficient?
                  an increased risk of sudden heart failure) is:         Explain.
                                                                   43.  Mutations in the HPRT1 gene in humans result in at
                        5′ CAACGCTTAGGATGTGCGGAGCCT 3′                 least two clinical syndromes. Consult OMIM (www
                                                                       .omim.org) by querying HPRT1; you will only need
                  The genomic DNA of four people (1–4), three of       to look briefly at the top three hits (files #300322,
                  whom have the disorder, was subjected to single-     300323, and 308000).
                  molecule sequencing. The following sequences repre-
                  sent all those obtained from each person. Nucleotides   a.  What is the full name of the HPRT1 enzyme?
                  different from the RefSeq are underlined.            b.  On which chromosome is the HPRT1 gene located?
   105   106   107   108   109   110   111