Page 46 - Genetics_From_Genes_to_Genomes_6th_FULL_Part3

340 Chapter 9 Digital Analysis of DNA

25. Eukaryotic genomes are replete with repetitive se- 1A: CCGGGAACTCCTAGTGCCTGTGGCACGATCCTATCAAC
quences that make genome assembly from sequence 1B: AGGACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCT
reads difficult. For example, sequences such as 2A: GTTTTTGAGAGAGAGAGAGAGAGAGAGAGACCTGGGGG
CTCTCTCTCT . . . (tandem repeats of the dinucleo- 2B: ACGTAGCTAGCTAACCGGTTAAGCGCGCATTACTTCAA
tide sequence CT) are found at many chromosomal
locations, with variable numbers (n) of the CT repeat- 3A: CTCTCTCTCTCTCTCTCTCTCAAAAACTATGGAAATTT
ing unit at each location. Scientists can assemble 3B: TAGTGATAGGTAACCCAGGTACTGCACCACCAGAAGTC
genomes despite these difficulties by using the paired- 4A: GGCCGGCCGTTGTTGACGCAATCATGAATTTAATGCCG
end sequencing strategy diagrammed in Fig. 9.9. In 4B: TCATGGGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA
other words, they can make libraries with genomic 5A: TAGTGCCTGTGGCACGATCCTATCAACTAACGACTGCT
inserts of defined size, and then sequence both ends 5B: AAGGAAAGGCCGGCCGTTGTTGACGCAATCATGAATTT
of individual clones. 6A: CAGCAGCTAGTGATAGGTAACCCAGGTACTGCACCACC
Following are 12 DNA sequence reads from six 6B: GGACTATACGTAGCTAGCTAACCGGTTAAGCGCGCATT
cloned fragments analyzed in a genome project. 1A
and 1B represent the two end reads from clone 1, 2A a. Diagram the two loci, showing the locations of
and 2B the two end reads from clone 2, etc. Clones the repetitive DNA and the relative positions and
1–4 were obtained from a library in which the ge- orientations of the 12 DNA sequence reads.
nomic inserts are about 2 kb long, while the inserts in b. If possible, indicate how many copies of the CT
clones 5 and 6 are about 4 kb long. All of these se- repeating unit reside at either locus.
quences have their 5′ ends at the left and their 3′ ends c. Are the data compatible with the alternative
at the right. To simplify your analysis, assume that hypothesis that these clones actually represent two
these sequences together represent two genomic loca- alleles of a single locus that differ in the number
tions (loci; singular locus), each of which contains a of CT repeating units?
(CT) n repeat, and that each of the 12 sequences over-
laps with one and only one other sequence.