Page 152 - Genetics_From_Genes_to_Genomes_6th_FULL_Part2

Problems 311

growing chain will this building block be added? the yeast gene is given here. What is the sequence
How many building blocks will there be in the of nucleotides of the mRNA in this region of the
chain when it is completed? gene? Show the 5′ and 3′ directionality of your
c. What other building blocks have a known strand.
identity?
d. What details could you add to this figure that 5′ GTAAGTTAACTTTCGACTAGTCCAGGGT 3′
would be different in a eukaryotic cell versus a c. What is the sequence of amino acids in this part of
prokaryotic cell? the yeast mitotic spindle protein?
28. a. Can a tRNA exist that has the anticodon 33. The sequence of a complete eukaryotic gene encoding
sequence 5′ IAA? If so, which amino acid the small protein Met Tyr Arg Gly Ala is shown here.
would it carry? All of the written sequences on the template strand
b. Answer the same question for the anticodon se­ are transcribed into RNA.
5 2
quence 5′ xm s UAA. 5′ CCCCTATGCCCCCCTGGGGGAGGATCAAAACACTTACCTGTACATGGC 3′
29. For parts (a) and (b) of Problem 28, consider the 3′ GGGGATACGGGGGGACCCCCTCCTAGTTTTGTGAATGGACATGTACCG 5′
DNA sequence of the gene encoding the tRNA. What a. Which strand is the template strand? In which di­
is the sequence of the RNA­like strand of the tRNA rection (right­to­left or left­to­right) does RNA
gene corresponding to the tRNA’s anticodon? What is polymerase move along the template as it tran­
the sequence of the template strand of the gene for these scribes this gene?
same three nucleotides? Be sure to indicate polarities. b. What is the sequence of the nucleotides in the pro­
30. Remembering that the wobble base of the tRNA is the cessed mRNA molecule for this gene? Indicate the
5′ base of the anticodon: 5′ and 3′ polarity of this mRNA.
a. In human tRNAs, what are the sequences of all c. A single base mutation in the gene results in syn­
possible anticodons that were originally transcribed thesis of the peptide Met Tyr Thr. What is the se­
with A in the wobble position? (Assume this A is quence of nucleotides making up the mRNA
always modified to I.) produced by this mutant gene?
b. In human tRNAs, what are the sequences of all 34. Arrange the following list of eukaryotic gene ele­
possible anticodons that were originally transcribed ments in the order in which they would appear in the
with U in the wobble position? (Note: Any single genome and in the direction traveled by RNA poly­
type of tRNA with a U at the wobble position can merase along the gene. Assume the gene’s single
be modified only in a single way.) intron interrupts the open reading frame. Note that
c. How might the wobble Us in each of the anticodons some of these names are abbreviated and thus do not
in (b) be modified and still be consistent with the distinguish between elements in DNA versus RNA.
genetic code? For example, splice-donor site is an abbreviation for
d. What is the theoretical minimal number of DNA sequences transcribed into the splice-donor site
different tRNA genes that must exist in the because splicing takes place on the gene’s RNA tran­
5
human genome? (Assume that xo U pairs with A, script, not on the gene itself. Geneticists often use
G, or U only.) this kind of shorthand for simplicity, even though
31. The human genome contains about 500 genes for it is imprecise. (a) splice­donor site; (b) 3′ UTR;
(c) promoter; (d) stop codon; (e) nucleotide to
tRNAs. which methylated cap is added; (f) initiation codon;
a. Do you think that each one of these tRNA genes (g) transcription terminator; (h) splice­acceptor
has a different function? site; (i) 5′ UTR; (j) poly­A addition site; (k) splice
b. Can you explain why the human genome branch site.
might have evolved so as to house so many 35. Concerning the list of eukaryotic gene elements in
tRNA gen es? Problem 34:
32. The yeast gene encoding a protein found in the a. Which of the element names in the list are abbrevi­
mitotic spindle was cloned by a laboratory studying ated? (That is, which of these elements actually oc­
mitosis. The gene encodes a protein of 477 amino cur in the gene’s primary transcript or mRNA
acids. rather than in the gene itself?)
a. What is the minimum length in nucleotides of the b. Which of the elements in the list are found partly
protein­coding part of this yeast gene? or completely in the first exon of this gene (or in
b. A partial sequence of one DNA strand in an the RNA transcribed from this exon)? In the in­
exon containing the middle of the coding region of tron? In the second exon?