Page 149 - Genetics_From_Genes_to_Genomes_6th_FULL_Part2

308 Chapter 8 Gene Expression: The Flow of Information from DNA to RNA to Protein

Section 8.1 in the rIIB gene near the FC0 mutation. Describe a
2. Match the hypothesis from the left column to the ob- different kind of mutation in the rIIB gene these
servation from the right column that gave rise to it. researchers might have recovered by treating the
a. existence of an inter- 1. two mutations affecting the FC0 mutant with proflavin and looking for restored
+
rIIB function.
mediate messenger same amino acid can recombine
between DNA and to give wild type b. How could Crick and Brenner tell the difference
protein between the occurrence described in part (a) and
b. the genetic code is 2. one or two base deletions an intragenic suppressor like FC7?
nonoverlapping (or insertions) in a gene disrupt
its function; three base deletions c. When FC7 was separated from FC0 by recombina-
−
(or insertions) are often tion, the result was two rIIB mutant phages: One
compatible with function was FC7 and the other was FC0. How could they
−
c. the codon is more than 3. artificial messages containing discriminate between the rIIB recombinants that
one nucleotide certain codons produce shorter were FC7 and those that were FC0?
proteins than messages not
containing those codons d. Explain how Crick and Brenner could obtain dif-
d. the genetic code is based 4. protein synthesis occurs in the ferent deletion (−) or addition (+) mutations so as
on triplets of bases cytoplasm, while DNA resides to make the various combinations such as ++, −−,
in the nucleus +++, and −−− shown in Fig. 8.4c.
e. stop codons exist and 5. artificial messages with S
terminate translation different base sequences gave 6. The Hbβ (sickle-cell) allele of the human β-globin
rise to different proteins in an gene changes the sixth amino acid in the β-globin
C
in vitro translation system chain from glutamic acid to valine. In Hbβ , the sixth
f. the amino acid sequence 6. single base substitutions affect amino acid in β-globin is changed from glutamic acid
of a protein depends on only one amino acid in the to lysine. What would be the order of these two muta-
the base sequence of protein chain tions within the map of the β-globin gene?
an mRNA
3. How would the artificial mRNA 7. The following diagram describes the mRNA sequence
of part of the A gene and the beginning of the B gene
5′. . . GUGUGUGU . . . 3′ of phage ϕX174. In this phage, some genes are read in
be read according to each of the following models for overlapping reading frames. For example, the code for
the genetic code? the A gene is used for part of the B gene, but the reading
a. two-base, not overlapping frame is displaced by one base. Shown here is the single
b. two-base, overlapping mRNA with the codons for proteins A and B indicated.
c. three-base, not overlapping aa# 5 6 7 8 9 10 11 12 13 14 15 16
d. three-base, overlapping A AlaLysGluTrpAsnAsnSerLeuLysThrLysLeu
e. four-base, not overlapping mRNA GCUAAAGAAUGGAACAACUCACUAAAAACCAAGCUG
4. An example of a portion of the T4 rIIB gene in which B MetGluGlnLeuThrLysAsnGlnAla
aa# 1 2 3 4 5 6 7 8 9
Crick and Brenner had recombined one + and one −
mutation is shown here. (The RNA-like strand of the Given the following amino acid (aa) changes, indicate
DNA is shown.) the base change that occurred in the mRNA and the
consequences for the other protein sequence.
wild type 5′ AAA AGT CCA TCA CTT AAT GCC 3′
mutant 5′ AAA GTC CAT CAC TTA ATG GCC 3′ a. Asn at position 10 in protein A is changed to Tyr.
a. Where are the + and − mutations in the mutant DNA? b. Leu at position 12 in protein A is changed to Pro.
b. The double mutant produces wild-type plaques. c. Gln at position 8 in protein B is changed to Leu.
What alterations in amino acids occurred in this d. The occurrence of overlapping reading frames is
double mutant? very rare in nature. When it does occur, the extent
c. How can you explain the fact that amino acids are of the overlap is not very long. Why do you think
different in the double mutant than in the wild-type this is the case?
sequence, yet the phage has a wild-type phenotype? 8. The amino acid sequence of part of a protein has been
5. Consider Crick and Brenner’s experiments in Fig. 8.4, determined:
which showed that the genetic code is based on nucle-
otide triplets. N . . . Gly Ala Pro Arg Lys . . . C
a. Crick and Brenner obtained FC7, an intragenic sup- A mutation has been induced in the gene encoding
pressor of FC0, that was a mutation in a second site this protein using the mutagen proflavin. The resulting