Page 101 - Genetics_From_Genes_to_Genomes_6th_FULL_Part2

260 Chapter 7 Anatomy and Function of a Gene: Dissection Through Mutation

PROBLEMS

Vocabulary 5. Over a period of several years, a large hospital kept
1. The following is a list of mutational changes. For each track of the number of births of babies displaying the
of the specific mutations described, indicate which of trait achondroplasia. Achondroplasia is a very rare
the terms in the right-hand column applies, either as a autosomal dominant condition resulting in dwarfism
description of the mutation or as a possible cause. with abnormal body proportions. After 120,000
More than one term from the right column can apply births, it was noted that 27 babies had been born with
to each statement in the left column. achondroplasia. One physician was interested in de-
1. an A–T base pair in the wild-type gene is a. transition termining how many of these dwarf babies resulted
changed to a G–C pair b. base from new mutations and whether the apparent muta-
2. an A–T base pair is changed to a T–A pair substitution tion rate in this geographical area was higher than
3. the sequence AAGCTTATCG is changed to c. transversion normal. He looked up the families of the 27 dwarf
AAGCTATCG d. deletion births and discovered that four of the dwarf babies
4. the sequence CAGCAGCAGCAGCAGCAG e. insertion had a dwarf parent. What is the apparent mutation
is changed to rate of the achondroplasia gene in this population? Is
CAGCAGCAGCAGCAGCAGCAGCAG f. deamination it unusually high or low?
5. the sequence AACGTTATCG is changed to g. X-ray 6. Suppose you wanted to study genes controlling the
AATGTTATCG irradiation
6. the sequence AACGTCACACACACATCG h. intercalator structure of bacterial cell surfaces. You decide to
is changed to AACGTCACATCG i. slipped start by isolating bacterial mutants resistant to in-
7. the sequence AAGCTTATCG is changed to mispairing fection by a bacteriophage that binds to the cell
AAGCTTTATCG surface. The selection procedure is simple: Spread
cells from a culture of sensitive bacteria on a petri
Section 7.1 plate, expose them to a high concentration of
phages, and pick the bacterial colonies that grow.
2. What explanations can account for the following pedi- To set up the selection you could (1) spread cells
gree of a very rare trait? Be as specific as possible. from a single liquid culture of sensitive bacteria on
How might you be able to distinguish between these many different plates and pick every resistant col-
explanations? ony; or (2) start many different cultures, each
I grown from a single colony of sensitive bacteria,
spread one plate from each culture, and then pick a
single mutant from each plate. Which method
II
would ensure that you are isolating many indepen-
dent mutations?
III
7. In a genetics lab, Kim and Maria infected a sample
IV from an E. coli culture with a particular virulent bac-
teriophage. They noticed that most of the cells were
3. The DNA sequence of one strand of a gene from three lysed, but a few survived. The survival rate in their
independently isolated mutants is given here (5′ ends sample was about 1 × 10 . Kim was sure the bacte-
−4
are at left). Using this information, what is the se- riophage induced the resistance in the cells, while
quence of the wild-type gene in this region? Maria thought that resistant mutants probably already
existed in the sample of cells they used. Earlier, for a
mutant 1 ACCGTAATCGACTGGTAAACTTTGCGCG
mutant 2 ACCGTAGTCGACCGGTAAACTTTGCGCG different experiment, they had spread a dilute suspen-
sion of E. coli onto solid medium in a large petri dish,
mutant 3 ACCGTAGTCGACTGGTTAACTTTGCGCG 5
and, after seeing that about 10 colonies were growing
4. Among mammals, measurements of the rate of genera- up, they had replica-plated that plate onto three other
tion of autosomal recessive mutations have been made plates. Kim and Maria decide to use these plates to
almost exclusively in mice, while many measurements test their theories. They pipette a suspension of the
of the rate of generation of dominant mutations have bacteriophage onto each of the three replica plates.
been made both in mice and in humans. What do you What should they see if Kim is right? What should
think is the reason for this difference? they see if Maria is right?